rs36979 chr5:1503495 T>C
- Sequence
gatgccttacggccacggtctctc[T/C]aatactgaaagctagcttcagcgc
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.74 | -0.32 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP eye color, fasting insulin, homa-b, homa-ir, ldl cholesterol change with statins, schizophrenia, total cholesterol change with statins