rs371809 chr1:91166384 G>A
- Sequence
ttgggaggcaagtcccatagagca[G/A]agagctttgaaaaatcgttttcct
- ASB in cell types
- THP-1 (acute monocytic leukemia) CUTLL1 (T-cell lymphoblastic lymphoma 1)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.88 | 0.35 | 2.00 | |||
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 1.78 | -0.12 | 1.00 |
Items per page:
1 – 2 of 2