rs3736907 chr1:117018307 C>A
- Sequence
gttccagccagctagctctcacat[C/A]ttccaccagcttattcgaatcacc
- ASB in cell types
- MDA-MB-231ERb(triple negative breast cancer) MDA-MB-231 (breast adenocarcinoma)
- ASB for transcription factors
- ESR2_HUMAN SRC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR2_HUMAN | 1.29 | n/a | 5.00 | n/a | No Hit | |||
| SRC_HUMAN | 2.38 | -1.98 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, chronic kidney disease, hdl cholesterol, infant head circumference, triglycerides
GTEx eQTL Artery_Tibial, Cells_EBV-transformed_lymphocytes, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood