rs3738719 chr1:226608816 C>A
- Sequence
ccggaaccctgcagcctggggccc[C/A]agcccgcctgcagctcagctttcc
- ASB in cell types
- CD34+ stem cells-derived erythroblasts tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 2.06 | -1.19 | 2.00 | |||
| tibial nerve | 2.24 | -2.06 | 1.00 |
Items per page:
1 – 2 of 2