rs374111211 chr2:89826246 G>A
- Sequence
ttccattccagtccattccattcc[G/A]ttccattccattccattcctttcg
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.55 | -0.66 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.85 | 0.07 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.32 | -0.50 | 1.12 |
Items per page:
1 – 3 of 3