rs3744061 chr17:76737321 G>A
- Sequence
cgggctccgcaggctagcgcacct[G/A]agtaacaactgggcgggcagccgg
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma) fetal bone marrow-derived mononuclear cells HEK293T (embryonic kidney)
- ASB for transcription factors
- KMT2A_HUMAN MEN1_HUMAN NELFA_HUMAN SNAI2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2A_HUMAN | 2.01 | -0.26 | 1.07 | n/a | n/a | |||
| MEN1_HUMAN | 1.84 | n/a | 2.50 | n/a | n/a | |||
| NELFA_HUMAN | n/a | 0.67 | 1.50 | n/a | n/a | |||
| SNAI2_HUMAN | 1.61 | -2.81 | 1.50 | n/a | No Hit | |||
| RBM25_HUMAN | -0.14 | 1.23 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, college completion, cystatin c in serum, total cholesterol, type 2 diabetes, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood