rs3745655 chr19:12441249 G>C
- Sequence
ttcctgacacagcccttggcaggg[G/C]gggcttcctccctgctctttgatc
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia) 2588 (Lymphoblastoid Cell Lines) HepG2 (hepatoblastoma)
- ASB for transcription factors
- PBX1_HUMAN RBM25_HUMAN CTCF_HUMAN FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX1_HUMAN | 1.63 | n/a | 1.33 | n/a | No Hit | |||
| RBM25_HUMAN | n/a | 2.27 | 4.00 | n/a | n/a | |||
| CTCF_HUMAN | 1.21 | 0.47 | 1.05 | n/a | No Hit | |||
| FOXA2_HUMAN | 1.95 | -1.68 | 1.00 | n/a | No Hit | |||
| BCL6_HUMAN | 2.18 | -3.60 | 1.33 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood