rs3752949 chr10:103910745 A>G
- Sequence
atccatgctgtttgctgaaattct[A/G]gacttaagaatcagtccttgacaa
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 2.54 | -2.26 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, arthritis including non-rheumatoid, college completion, hip bone mineral density (bmd), hypertension (early onset hypertension), intracranial aneurysm (male), ldl cholesterol change with statins, mitral annular calcium, paternal transmission distortion, premature ovarian failure, relative telomere length, sporadic creutzfeldt-jakob disease, tetrology of fallot, total cholesterol, total cholesterol change with statins, years of education