rs3757593 chr7:76049417 G>A
- Sequence
gctgggtgctgcaggggataccaa[G/A]ataagtgagaagtgacacttgata
- ASB in cell types
- K562 (myelogenous leukemia) embryonic stem cells derived definitive endoderm
- ASB for transcription factors
- ARI1B_HUMAN ZEB2_HUMAN HTF4_HUMAN MTG8R_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | 2.89 | -2.62 | 1.00 | n/a | n/a | |||
| ZEB2_HUMAN | 2.45 | -1.35 | 1.00 | n/a | n/a | |||
| HTF4_HUMAN | 2.54 | -0.23 | 1.50 | n/a | No Hit | |||
| MTG8R_HUMAN | 2.37 | -4.28 | 1.50 | n/a | n/a | |||
| NFIC_HUMAN | 1.83 | -1.63 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood