rs3761925 chr1:6701642 C>T
- Sequence
ccgacggacccgagcctcccgtgg[C/T]gggggtggggcggccaccgccagc
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells
- ASB for transcription factors
- HDAC1_HUMAN NR2C2_HUMAN ZN148_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | -0.33 | 1.55 | 1.00 | n/a | n/a | |||
| NR2C2_HUMAN | 0.98 | 2.40 | 1.33 | n/a | No Hit | |||
| ZN148_HUMAN | -0.82 | 2.90 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood