rs3780928 chr10:106175960 G>T
- Sequence
aaaaggcttgaatttagacatatc[G/T]agagagtgccaccttgtgggtaaa
- ASB in cell types
- foreskin keratinocyte MS-1 (Small cell lung carcinoma) GM02255 (Lymphoblastoid Cell Lines) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.58 | 2.50 | |||
| MS-1 (Small cell lung carcinoma) | 0.90 | -0.91 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.91 | -0.38 | 1.00 | |||
| hepatocytes | -0.63 | 1.19 | 1.00 | |||
| erythroid progenitors | 2.19 | n/a | 2.00 |
Items per page:
1 – 5 of 5