rs3781743 chr11:20610313 G>A
- Sequence
gctcctgccgcccggtggtgggag[G/A]ggatattgcaggaggcttggggct
- ASB in cell types
- WA09 (embryonic stem cells) GBM39 (Human brain tumor) H929 (plasma cell myeloma) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.86 | 0.57 | 1.27 | |||
| GBM39 (Human brain tumor) | 1.07 | -3.33 | 2.00 | |||
| H929 (plasma cell myeloma) | -3.73 | 2.33 | 1.50 | |||
| A549 (lung carcinoma) | 0.73 | 0.41 | 2.00 | |||
| GM12868 (female B-cells) | 2.92 | n/a | 1.50 |
Items per page:
1 – 5 of 11