rs3784387 chr15:89894138 G>A
- Sequence
tggagggcaggtgcggatgccgag[G/A]agagtggtcacctcggccagcgtt
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TYY1_HUMAN TIF1B_HUMAN STAG1_HUMAN ZFX_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 0.89 | 0.58 | 1.42 | n/a | No Hit | |||
| TIF1B_HUMAN | 2.26 | -4.50 | 2.00 | n/a | n/a | |||
| STAG1_HUMAN | 0.20 | 1.02 | 1.00 | n/a | n/a | |||
| ZFX_HUMAN | 0.45 | 1.36 | 1.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood