rs3786142 chr17:41526792 G>A
- Sequence
taccatgtttgccaggctgatctc[G/A]aactcctggggctcaagcaatcct
- ASB in cell types
- HCT-116 (colon carcinoma)
- ASB for transcription factors
- CDK8_HUMAN SPT6H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | 1.76 | -1.49 | 1.00 | n/a | n/a | |||
| SPT6H_HUMAN | 2.00 | -0.47 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid