rs3797340 chr5:119356042 C>G
- Sequence
tgcagagcgaacttgcggctcgtc[C/G]gagtacatgtgagcggtaatcgcc
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.48 | -0.69 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Liver, Spleen, Thyroid, Whole_Blood