rs3803184 chr12:48004219 G>C
- Sequence
catggaaagcaggcaggcaggcag[G/C]ggcgggggaagacttacggacatc
- ASB in cell types
- HDF(human dermal fibroblasts) SMMC-7721 (hepatocellular carcinoma)
- ASB for transcription factors
- EZH2_HUMAN PTEN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 1.82 | 0.35 | 1.00 | n/a | n/a | |||
| PTEN_HUMAN | 1.87 | -3.21 | 1.33 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood