rs3804037 chr21:45973906 C>G
- Sequence
gagagggcgggaacgcaaccccag[C/G]accctgcggctcccgccacggggt
- ASB in cell types
- ascending aorta neural cell HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- CTCF_HUMAN SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.24 | 0.23 | 1.19 | n/a | No Hit | |||
| SMC3_HUMAN | 2.42 | -2.16 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Spleen, Thyroid, Whole_Blood