rs3807230 chr7:154684844 C>T
- Sequence
gagtctttagaaggtcctcagata[C/T]cactgctgtctacttcctgtaaat
- ASB in cell types
- Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | 0.27 | 1.98 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, mean bilateral hippocampal volume (excluding patients with neuropsychiatric disorders), total brain volume (excluding patients with neuropsychiatric disorders), total cholesterol, waist hip ratio