rs3807505 chr7:16644622 G>C
- Sequence
tcaccacattaattgcccggagtc[G/C]cacgcatcaccatccctgcaccgt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.73 | 0.10 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Colon_Transverse, Heart_Atrial_Appendage, Muscle_Skeletal, Testis, Thyroid