rs3807782 chr7:78040382 G>A
- Sequence
aaggaggacgggcgccccctggcg[G/A]cccctggtcgtgccgcagcctcac
- ASB in cell types
- foreskin keratinocyte PANC1 (pancreatic ductal adenocarcinoma) transverse colon adrenal gland
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.81 | 0.64 | 1.46 | -5.86 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
