rs3809817 chr17:7329843 C>G
- Sequence
cccgactgaggacgaagtgtcttg[C/G]aacagtgcggcagtccttccactt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- SPI1_HUMAN IKZF2_HUMAN ZN600_HUMAN CBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.45 | 0.15 | 1.37 | n/a | No Hit | |||
| IKZF2_HUMAN | 1.50 | -0.25 | 1.00 | n/a | n/a | |||
| ZN600_HUMAN | n/a | 1.86 | 2.00 | n/a | n/a | |||
| CBP_HUMAN | 2.11 | -4.57 | 2.00 | n/a | n/a | |||
| ZN143_HUMAN | 2.27 | -1.79 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood