rs3810177 chr19:49031767 T>C
- Sequence
gggcccgagggcacgcgcaaccgg[T/C]cggagccacaatagctcggggtgt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- TBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBP_HUMAN | 2.63 | -2.25 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting blood glucose, irritible bowel syndrome, nonalcoholic fatty liver disease, triglycerides, urinary albumin-to-creatinine ratio
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Pancreas, Testis