rs3812142 chr6:83431674 T>C
- Sequence
ccctctttctacagatccacaacc[T/C]tcgccgtgccatccaggatgccgg
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.20 | 0.84 | 2.68 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Liver, Muscle_Skeletal