rs3814949 chr14:105890095 C>A
- Sequence
gcagtgctgtctgggctggagcag[C/A]cttagatgccaggtcagggtggcc
- ASB in cell types
- Jurkat (T-cells) MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Jurkat (T-cells) | -0.31 | 1.61 | 1.80 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -0.29 | 1.41 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Colon_Transverse, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood