rs3822751 chr5:95818506 C>G
- Sequence
tcctgtggttcttattctcctgca[C/G]taggtttccccagcctcagccagg
- ASB in cell types
- macrophages form periferal blood CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.30 | 0.61 | 1.52 | n/a | No Hit |
Items per page:
1 – 1 of 1