rs3845839 chr2:224402164 G>A
- Sequence
acttagtacaggaaatgaccggcc[G/A]aaaaggaacatgagttggctctgt
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- GATA1_HUMAN GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 0.06 | 2.71 | 2.00 | n/a | No Hit | |||
| GATA2_HUMAN | -1.07 | 1.68 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2