rs3848595 chr19:33144001 G>C
- Sequence
attgtctgggtccacagggatggg[G/C]tcgtgcttctaaatgcccagtgtg
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) MCF7 (Invasive ductal breast carcinoma) GM18486 (Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- CTCF_HUMAN CENPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.69 | 0.75 | 1.41 | n/a | No Hit | |||
| CENPA_HUMAN | -0.97 | 2.53 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), college completion, diastolic blood pressure (dbp), total cholesterol change with statins, triglycerides, triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Colon_Sigmoid, Liver, Muscle_Skeletal, Nerve_Tibial