rs3861865 chr9:123955179 G>A
- Sequence
tttagctttaaaaatattgattgc[G/A]caactcggtgagattggctaactt
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma) SU-DHL-1 (Anaplastic large cell lymphoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 3.31 | n/a | 2.00 | 2.22 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, sporadic creutzfeldt-jakob disease, tardive dyskinesia