rs386766 chr1:30482018 G>A
- Sequence
aatagtgtgggataccagagctcg[G/A]ggcattctcagcctccatactagc
- ASB in cell types
- WA01 (H1, human embryonic stem cells) CD34+ hematopoietic stem cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 1.51 | -0.32 | 1.00 | |||
| CD34+ hematopoietic stem cells | -5.01 | 2.92 | 2.00 |
Items per page:
1 – 2 of 2