rs3903801 chr6:24559205 A>G
- Sequence
cagccacatggtcagatggtgact[A/G]ccatgacacgcccaccacagcatc
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | -0.15 | 1.52 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, fasting insulin, hdl cholesterol, homa-ir
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg