rs392512 chr5:157309302 C>T
- Sequence
gccctctggtgttaggtattatta[C/T]ggttttaattgctttgaaagtaca
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM10847 (female B-cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) Peyer's patch
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.11 | 1.40 | 1.66 | n/a | No Hit | |||
| STAG1_HUMAN | 1.49 | 2.34 | 1.14 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, resistance to kuru in aged women despite likely exposure, schizophrenia, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Whole_Blood