rs39452 chr7:25093790 T>C
- Sequence
ctagttaaaattttatctcatgca[T/C]tagtcaaaatgcaaatctttaggc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.12 | 0.82 | 1.19 | |||
| H929 (plasma cell myeloma) | 2.08 | -1.64 | 1.00 |
Items per page:
1 – 2 of 2