rs396129 chr10:117442138 G>A
- Sequence
attggccaaatccagtagccttgg[G/A]caagttgcacccaggggagggcac
- ASB in cell types
- MCF10A (breast epithelial cells) MSC (mesenchymal stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10A (breast epithelial cells) | 1.94 | -0.05 | 1.17 | |||
| MSC (mesenchymal stem cells) | 1.68 | -0.29 | 1.50 |
Items per page:
1 – 2 of 2