rs39745 chr7:118065203 C>T
- Sequence
ccttttcacatgctggtcctttga[C/T]ctaggattatcttctctccctttc
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -1.01 | 1.63 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, biploar disorder (bipolar schizoaffective disorder), fasting insulin, homa-ir, neuroblastoma (brain cancer), partial epilepsy, rheumatoid arthritis, severe diabetic retinopathy, total cholesterol