rs4124874 chr2:233757013 T>G
- Sequence
agctggccaagggtagagttcagt[T/G]tgaacaaagcaatttgagaacatc
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- JUN_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 2.32 | -1.26 | 2.17 | n/a | No Hit | |||
| EP300_HUMAN | 2.89 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, comorbid depressive syndrome and alcohol dependence, parkinsons disease, total bilirubin, total cholesterol, total serum bilirubin, urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Heart_Atrial_Appendage, Liver, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis