rs41314489 chr10:118755322 G>A
- Sequence
acgacgaggccctcgccggttcct[G/A]aggacgcgcgcggagcagtcttgg
- ASB in cell types
- HepG2 (hepatoblastoma) A549 (lung carcinoma) SUM159PT (Triple negative breast cancer) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- TYY1_HUMAN RFX5_HUMAN RBM25_HUMAN CENPT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | -4.29 | 4.18 | 1.00 | n/a | No Hit | |||
| RFX5_HUMAN | n/a | 3.34 | 2.00 | 0.80 | Weak Concordant | |||
| RBM25_HUMAN | -1.26 | 2.92 | 1.00 | n/a | n/a | |||
| CENPT_HUMAN | -1.38 | 1.61 | 1.00 | n/a | n/a | |||
| SPT5H_HUMAN | 1.99 | 0.13 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood