rs41438744 chr14:102087077 G>C
- Sequence
acccccgcgcctgccttatatagc[G/C]acgggcccgcccagcgcgcggcgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM02630 (Fanconi anemi)
- ASB for transcription factors
- NRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | -2.73 | 1.79 | 1.50 | 0.56 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis