rs4146429 chr10:102641875 T>C
- Sequence
tagaggaataaatgcctatcttgc[T/C]aggtagtttaaagtgccagggatg
- ASB in cell types
- 22RV1 (prostate carcinoma) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ANDR_HUMAN SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.84 | -4.19 | 2.00 | n/a | No Hit | |||
| SPT5H_HUMAN | 1.70 | -0.22 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI body mass index, body mass index (joint analysis main effects and physical activity interaction), body mass index in physically active individuals
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, bipolar disorder, birth weight, body mass index (bmi), coronary artery disease (cad), diastolic blood pressure (dbp), systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid