rs416768 chr1:220690029 C>G
- Sequence
cgtgactatctcgccatgccctcc[C/G]tagcactgagcgtgatctctagta
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) GM19239 (male B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.23 | 1.89 | 1.07 | n/a | n/a |
Items per page:
1 – 1 of 1