rs41700 chr7:120999563 A>C
- Sequence
taaaattgagccattccttttata[A/C]atttttatattgtaactggattgg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.03 | 0.67 | 1.56 |
Items per page:
1 – 1 of 1