rs4234798 chr4:7218206 T>G
- Sequence
gcaattagagaaatccccaacgag[T/G]agatcctgcattcctcactgcact
- ASB in cell types
- liver NRCC RCC 7860 (Renal cell carcinoma)
- ASB for transcription factors
- TF65_HUMAN HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.80 | -4.05 | 1.50 | n/a | No Hit | |||
| HNF4A_HUMAN | 1.81 | -1.50 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, circulating igfbp-3 concentrations, college completion, comorbid depressive syndrome and alcohol dependence, refractive error, years of education
GTEx eQTL Adipose_Visceral_Omentum, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid