rs42425 chr5:36178191 C>T
- Sequence
cagtatcttagagttgatcaggtg[C/T]ccaacatgtcttgaatgcggctgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) uterus pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.32 | -0.07 | 2.50 | |||
| uterus | 2.76 | 0.48 | 1.00 | |||
| pancreas | 0.75 | -0.59 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood