rs4281471 chr11:43515163 G>C
- Sequence
ggaatgatctttccttttggcaca[G/C]aagggccaggccagagcagcttca
- ASB in cell types
- HCT-116 (colon carcinoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.91 | -0.42 | 1.17 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP homa-b, microalbuminuria, obesity with early age of onset (age >2), type 2 diabetes, hypertension, coronary artery disease (cad), combined case analysis, gender differentiated, urinary albumin-to-creatinine ratio