rs4302936 chr9:17811163 G>C
- Sequence
cttcctccgtgaatttttccccat[G/C]gtttgttagctatcaatagccagt
- ASB in cell types
- Kelly (neuroblastoma) HCT-116 (colon carcinoma) HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | 2.43 | -1.32 | 1.50 | |||
| HCT-116 (colon carcinoma) | 1.70 | 0.03 | 1.05 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 0.04 | 1.22 | 2.00 |
Items per page:
1 – 3 of 3