rs4311638 chr8:140302442 A>G
- Sequence
aggaccttatctgtctgtagctgc[A/G]gaactaataaaaattgtacttagc
- ASB in cell types
- TF-1 (erythroleukemia)
- ASB for transcription factors
- GATA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA2_HUMAN | -0.27 | 2.37 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, eye color, hdl cholesterol change with statins, simpson-angus scale, triglycerides change with statins