rs4314499 chr6:53795560 C>T
- Sequence
gcattcacctgcttctttctcccc[C/T]tgtctctttacttccatcctttcc
- ASB for transcription factors
- ESR1_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 0.48 | 1.93 | 1.12 | n/a | No Hit | |||
| IKZF1_HUMAN | 2.47 | -0.22 | 1.25 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid