rs4330708 chr8:125220957 T>G
- Sequence
gctttctctaacttgggccctgtg[T/G]gtgctaaaaatatctcgaaggtat
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.73 | 0.26 | 1.03 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hdl cholesterol, ldl cholesterol change with statins, maternal transmission distortion, spine bone mineral density (bmd), stabilized warfarin dose, triglycerides
GTEx eQTL Esophagus_Mucosa, Lung, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis