rs4333960 chr10:108784156 A>T
- Sequence
cagcaccacctagtggaagaggga[A/T]cctgtccatgaggcacattgtcag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines) HT1080 (fibrosarcoma) prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.30 | 0.91 | 1.01 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 0.92 | -0.64 | 1.00 | |||
| HT1080 (fibrosarcoma) | 1.50 | -1.22 | 1.00 | |||
| prostate gland | 0.61 | 2.66 | 1.00 | |||
| SUM159PT (Triple negative breast cancer) | n/a | 2.49 | 1.00 |
Items per page:
1 – 5 of 5