rs4351323 chr7:16397445 A>G
- Sequence
ctgacacgtgtaacgtgtgatgta[A/G]cagacgtgacacgtgacatgtgac
- ASB in cell types
- HepG2 (hepatoblastoma) MSC (mesenchymal stem cells)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.42 | -4.33 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, decrease in fev1 (in asthmatic participants >=30 years old), decrease in fev1 (in asthmatic participants), lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), obesity with early age of onset (age >2)