rs436045 chr1:2140117 A>G
- Sequence
tccatgagcagcagtgcctgtcag[A/G]tttggtccaagcagtgccctcagg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) neutrophils from periferal blood neutrophils LUHMES (lund human mesencephalic cells)
- ASB for transcription factors
- STAG1_HUMAN RAD21_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.17 | -0.55 | 1.17 | n/a | n/a | |||
| RAD21_HUMAN | 0.01 | 2.16 | 1.57 | n/a | n/a | |||
| NR2C1_HUMAN | 1.99 | n/a | 1.25 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood